Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1001821
End position: 1001844
Length: 24

DNA sequence
>NC_019776, from 1001821 to 1001844 (24 bp); Cyanobacterium aponinum PCC 10605 TTACCATTACCATTAACACTACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1000810-1002828	Sequence	Cyan10605_0825 - Carbonate dehydratase (Protein is coded in complementary strand; from 1002828 to 1000810)