Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1079400
End position: 1079423
Length: 24

DNA sequence
>NC_019776, from 1079400 to 1079423 (24 bp); Cyanobacterium aponinum PCC 10605 CCCTAATACCCCAATACCCTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1079424-1080707	Sequence	Cyan10605_0883 - glutamyl-tRNA reductase (Protein is coded in complementary strand; from 1080707 to 1079424)