Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1205785
End position: 1205808
Length: 24

DNA sequence
>NC_019776, from 1205785 to 1205808 (24 bp); Cyanobacterium aponinum PCC 10605 AAGAATAATAATAAGAGTAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1205144-1208233	Sequence	Cyan10605_0995 - bacterial translation initiation factor 2 (bIF-2)