Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1285922
End position: 1285945
Length: 24

DNA sequence
>NC_019776, from 1285922 to 1285945 (24 bp); Cyanobacterium aponinum PCC 10605 TTCTTTATCTTTTTCTTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1285893-1286111	Sequence	Cyan10605_1054 - hypothetical protein (Protein is coded in complementary strand; from 1286111 to 1285893)