Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1341708
End position: 1341734
Length: 27

DNA sequence
>NC_019776, from 1341708 to 1341734 (27 bp); Cyanobacterium aponinum PCC 10605 TTCTTCTAATTCTTCTAATTCTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1341256-1342074	Sequence	Cyan10605_1107 - SSU ribosomal protein S2P (Protein is coded in complementary strand; from 1342074 to 1341256)