Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1474205
End position: 1474234
Length: 30

DNA sequence
>NC_019776, from 1474205 to 1474234 (30 bp); Cyanobacterium aponinum PCC 10605 TAATGAGAGATAATCAGAGCAACTGAGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1472454-1475150	Sequence	Cyan10605_1223 - Protein of unknown function DUF2344 (Protein is coded in complementary strand; from 1475150 to 1472454)