Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1475936
End position: 1475960
Length: 25

DNA sequence
>NC_019776, from 1475936 to 1475960 (25 bp); Cyanobacterium aponinum PCC 10605 TTAATTTGATTAAATTTAAGTTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1475282-1476157	Sequence	Cyan10605_1224 - MOSC domain protein beta barrel domain protein