Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 1728232
End position: 1728255
Length: 24

DNA sequence
>NC_019776, from 1728232 to 1728255 (24 bp); Cyanobacterium aponinum PCC 10605 ATTACTTAATTACTTAATTATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1728250-1730343	Sequence	Cyan10605_1444 - translation elongation factor 2 (EF-2/EF-G) (Protein is coded in complementary strand; from 1730343 to 1728250)