Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2169288
End position: 2169315
Length: 28

DNA sequence
>NC_019776, from 2169288 to 2169315 (28 bp); Cyanobacterium aponinum PCC 10605 GGTGTCAGGTGTCGGGTTTCAGGTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2168651-2169289	Sequence	Cyan10605_1811 - peptidase S16 lon domain protein