Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2271782
End position: 2271809
Length: 28

DNA sequence
>NC_019776, from 2271782 to 2271809 (28 bp); Cyanobacterium aponinum PCC 10605 TAGTGAATAATGAATAGTGAATAGTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2271807-2273312	Sequence	Cyan10605_1897 - major facilitator superfamily MFS_1 (Protein is coded in complementary strand; from 2273312 to 2271807)