Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2305402
End position: 2305428
Length: 27

DNA sequence
>NC_019776, from 2305402 to 2305428 (27 bp); Cyanobacterium aponinum PCC 10605 TCATCTTCATCATCTTCACCATCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2304691-2305620	Sequence	Cyan10605_1921 - hypothetical protein (Protein is coded in complementary strand; from 2305620 to 2304691)