Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2324496
End position: 2324519
Length: 24

DNA sequence
>NC_019776, from 2324496 to 2324519 (24 bp); Cyanobacterium aponinum PCC 10605 CGACGACGACGACGGCGACGACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2323872-2325926	Sequence	Cyan10605_1935 - ribonuclease, Rne/Rng family (Protein is coded in complementary strand; from 2325926 to 2323872)