Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2407353
End position: 2407397
Length: 45

DNA sequence
>NC_019776, from 2407353 to 2407397 (45 bp); Cyanobacterium aponinum PCC 10605 TTTGCACCAGTGAGATTTGCCCCACTGAGATTTGCTTCATTGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2406756-2407592	Sequence	Cyan10605_1999 - pentapeptide repeat protein (Protein is coded in complementary strand; from 2407592 to 2406756)