Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2667802
End position: 2667836
Length: 35

DNA sequence
>NC_019776, from 2667802 to 2667836 (35 bp); Cyanobacterium aponinum PCC 10605 TAGGCAACAGGCAATAGGCAATAGGTAATAGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2667708-2667887	Sequence	Cyan10605_2230 - hypothetical protein (Protein is coded in complementary strand; from 2667887 to 2667708)