Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2699333
End position: 2699360
Length: 28

DNA sequence
>NC_019776, from 2699333 to 2699360 (28 bp); Cyanobacterium aponinum PCC 10605 ACTCATTACTCATTACTCATTACTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2699360-2701573	Sequence	Cyan10605_2264 - transporter, cation-chloride cotransporter (CCC) family (Protein is coded in complementary strand; from 2701573 to 2699360)