Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2710150
End position: 2710177
Length: 28

DNA sequence
>NC_019776, from 2710150 to 2710177 (28 bp); Cyanobacterium aponinum PCC 10605 TAATTAAGAATTAAGAATTAAGAATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2710168-2710752	Sequence	Cyan10605_2273 - guanylate kinase (Protein is coded in complementary strand; from 2710752 to 2710168)