Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2748135
End position: 2748170
Length: 36

DNA sequence
>NC_019776, from 2748135 to 2748170 (36 bp); Cyanobacterium aponinum PCC 10605 CTCTAAACCTTTTTCCAAACCTTTCGCTAAACCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2747953-2748987	Sequence	Cyan10605_2306 - hypothetical protein (Protein is coded in complementary strand; from 2748987 to 2747953)