Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2785224
End position: 2785279
Length: 56

DNA sequence
>NC_019776, from 2785224 to 2785279 (56 bp); Cyanobacterium aponinum PCC 10605 TAATTTTTAATTTTTAATTCTTAATTCTTAATTCTTAATTCTTAATTCTTAATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2785277-2786188	Sequence	Cyan10605_2336 - cation diffusion facilitator family transporter (Protein is coded in complementary strand; from 2786188 to 2785277)