Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2828506
End position: 2828533
Length: 28

DNA sequence
>NC_019776, from 2828506 to 2828533 (28 bp); Cyanobacterium aponinum PCC 10605 ACCTGACACCTGACACCTGACACCTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2827688-2828536	Sequence	Cyan10605_2377 - precorrin-6x reductase (Protein is coded in complementary strand; from 2828536 to 2827688)