Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 2913129
End position: 2913155
Length: 27

DNA sequence
>NC_019776, from 2913129 to 2913155 (27 bp); Cyanobacterium aponinum PCC 10605 AAAAAATTAAGAAAATTAAAAAAGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2912432-2913247	Sequence	Cyan10605_2454 - peptidase M48 Ste24p (Protein is coded in complementary strand; from 2913247 to 2912432)