Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3063901
End position: 3063928
Length: 28

DNA sequence
>NC_019776, from 3063901 to 3063928 (28 bp); Cyanobacterium aponinum PCC 10605 TCCGAACCCCGAACTCCGAACTCCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3063929-3066973	Sequence	Cyan10605_2576 - cyclic nucleotide-regulated ABC bacteriocin/lantibiotic exporter (Protein is coded in complementary strand; from 3066973 to 3063929)