Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 30805
End position: 30832
Length: 28

DNA sequence
>NC_019776, from 30805 to 30832 (28 bp); Cyanobacterium aponinum PCC 10605 TATTCACTATACACTATACACTATACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 30833-32008	Sequence	Cyan10605_0023 - glycosyl transferase family 2 (Protein is coded in complementary strand; from 32008 to 30833)