Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3116380
End position: 3116403
Length: 24

DNA sequence
>NC_019776, from 3116380 to 3116403 (24 bp); Cyanobacterium aponinum PCC 10605 TTCTATTTCTCTTTCAATTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3114755-3116572	Sequence	Cyan10605_2615 - serine/threonine protein kinase (Protein is coded in complementary strand; from 3116572 to 3114755)