Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3136831
End position: 3136860
Length: 30

DNA sequence
>NC_019776, from 3136831 to 3136860 (30 bp); Cyanobacterium aponinum PCC 10605 ATCTTCGTCTTCATCTTCATCGTCATCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3136244-3137929	Sequence	Cyan10605_2634 - hypothetical protein (Protein is coded in complementary strand; from 3137929 to 3136244)