Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3163742
End position: 3163768
Length: 27

DNA sequence
>NC_019776, from 3163742 to 3163768 (27 bp); Cyanobacterium aponinum PCC 10605 TCGTCTAATTCTTCTAATTCGTCTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3162845-3164044	Sequence	Cyan10605_2654 - hypothetical protein (Protein is coded in complementary strand; from 3164044 to 3162845)