Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3215293
End position: 3215320
Length: 28

DNA sequence
>NC_019776, from 3215293 to 3215320 (28 bp); Cyanobacterium aponinum PCC 10605 ATTCTTAATTTTTAATTCTTAATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3215312-3216064	Sequence	Cyan10605_2702 - hypothetical protein (Protein is coded in complementary strand; from 3216064 to 3215312)