Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3312617
End position: 3312644
Length: 28

DNA sequence
>NC_019776, from 3312617 to 3312644 (28 bp); Cyanobacterium aponinum PCC 10605 AACTATTCACTATTCACTATTAACTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3312641-3313804	Sequence	Cyan10605_2780 - lipid-A-disaccharide synthase (Protein is coded in complementary strand; from 3313804 to 3312641)