Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3467718
End position: 3467753
Length: 36

DNA sequence
>NC_019776, from 3467718 to 3467753 (36 bp); Cyanobacterium aponinum PCC 10605 AACCTGCCGCTAAACCTGCCGCCGCCCCTGCCGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3465611-3468259	Sequence	Cyan10605_2915 - Cl- channel voltage-gated family protein (Protein is coded in complementary strand; from 3468259 to 3465611)