Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3488397
End position: 3488426
Length: 30

DNA sequence
>NC_019776, from 3488397 to 3488426 (30 bp); Cyanobacterium aponinum PCC 10605 CATCAAAATTAACCAAAATTTATCAGAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3487592-3488605	Sequence	Cyan10605_2936 - response regulator receiver modulated diguanylate cyclase