Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3672337
End position: 3672369
Length: 33

DNA sequence
>NC_019776, from 3672337 to 3672369 (33 bp); Cyanobacterium aponinum PCC 10605 TTTTCTCTTAATTCTCTCTTTAATTTCTCCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3671669-3673663	Sequence	Cyan10605_3109 - Excinuclease ABC subunit B (Protein is coded in complementary strand; from 3673663 to 3671669)