Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3736621
End position: 3736644
Length: 24

DNA sequence
>NC_019776, from 3736621 to 3736644 (24 bp); Cyanobacterium aponinum PCC 10605 ACACCAGCACCAACACAAGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3736045-3737403	Sequence	Cyan10605_3161 - Adenylosuccinate synthetase (Protein is coded in complementary strand; from 3737403 to 3736045)