Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3801134
End position: 3801181
Length: 48

DNA sequence
>NC_019776, from 3801134 to 3801181 (48 bp); Cyanobacterium aponinum PCC 10605 TAGGAGGCTCTACAGGAGGCTCTACGGGAGGCTCTACAGGAGGCTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3799705-3808977	Sequence	Cyan10605_3213 - filamentous hemagglutinin family outer membrane protein (Protein is coded in complementary strand; from 3808977 to 3799705)