Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 3909462
End position: 3909491
Length: 30

DNA sequence
>NC_019776, from 3909462 to 3909491 (30 bp); Cyanobacterium aponinum PCC 10605 TTTTTCTTCTTCTTTTTGTTTCTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3908590-3910122	Sequence	Cyan10605_3288 - peptidase M50 (Protein is coded in complementary strand; from 3910122 to 3908590)