Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 415017
End position: 415044
Length: 28

DNA sequence
>NC_019776, from 415017 to 415044 (28 bp); Cyanobacterium aponinum PCC 10605 ATTATTCACTATTCACTATTCATTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 415033-415953	Sequence	Cyan10605_0321 - hypothetical protein (Protein is coded in complementary strand; from 415953 to 415033)