Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 474409
End position: 474468
Length: 60

DNA sequence
>NC_019776, from 474409 to 474468 (60 bp); Cyanobacterium aponinum PCC 10605 AGAAGCCTGTCCTACAGAAGCCTGTCCTACAGAAGCCTGTCCTACAGAAGCCTGTCCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 471860-475453	Sequence	Cyan10605_0370 - transcription-repair coupling factor (Protein is coded in complementary strand; from 475453 to 471860)