Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 534857
End position: 534880
Length: 24

DNA sequence
>NC_019776, from 534857 to 534880 (24 bp); Cyanobacterium aponinum PCC 10605 TTCATCATCATCATCATCATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 533853-535613	Sequence	Cyan10605_0424 - hypothetical protein (Protein is coded in complementary strand; from 535613 to 533853)