Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 7485
End position: 7508
Length: 24

DNA sequence
>NC_019776, from 7485 to 7508 (24 bp); Cyanobacterium aponinum PCC 10605 GCTGTTTCTGTTGATGTTGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6177-7535	Sequence	Cyan10605_0004 - sodium/proton antiporter NhaS3, CPA2 family (Protein is coded in complementary strand; from 7535 to 6177)