Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 783809
End position: 783843
Length: 35

DNA sequence
>NC_019776, from 783809 to 783843 (35 bp); Cyanobacterium aponinum PCC 10605 ATTAACTATTCACTATTCACTATTCACTATTAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 783829-784152	Sequence	Cyan10605_0628 - hypothetical protein (Protein is coded in complementary strand; from 784152 to 783829)