Sequence retrieval

Genome: Cyanobacterium aponinum PCC 10605
Start position: 804177
End position: 804203
Length: 27

DNA sequence
>NC_019776, from 804177 to 804203 (27 bp); Cyanobacterium aponinum PCC 10605 ATTTTGCCAACTTTGCCAACTTTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 803920-804702	Sequence	Cyan10605_0647 - two-component response regulator (Protein is coded in complementary strand; from 804702 to 803920)