Sequence retrieval

Genome: Caldisphaera lagunensis DSM 15908
Start position: 1076706
End position: 1076750
Length: 45

DNA sequence
>NC_019791, from 1076706 to 1076750 (45 bp); Caldisphaera lagunensis DSM 15908 GTTGATGGAGTTGTGGTTGATGTTGTGGTGGTTGATGGAGTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1076592-1079294	Sequence	Calag_1071 - putative solute binding protein (Protein is coded in complementary strand; from 1079294 to 1076592)