Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 1465870
End position: 1465893
Length: 24

DNA sequence
>NC_019896, from 1465870 to 1465893 (24 bp); Bacillus subtilis subsp. subtilis str. BSP1 ATGATGACGATGATGATCTTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1465093-1465899	Sequence	A7A1_0346 - LevF (Phosphotransferase system PTS)