Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 3376487
End position: 3376510
Length: 24

DNA sequence
>NC_019896, from 3376487 to 3376510 (24 bp); Bacillus subtilis subsp. subtilis str. BSP1 TCTTTCTGTTTCTCTTTTGCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3376025-3378238	Sequence	A7A1_2412 - Hypothetical protein YebA (Protein is coded in complementary strand; from 3378238 to 3376025)