Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 283189
End position: 283213
Length: 25

DNA sequence
>NC_019896, from 283189 to 283213 (25 bp); Bacillus subtilis subsp. subtilis str. BSP1 AAAAATAAAAAAACAAAAAAAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 282996-283307	Sequence	A7A1_2107 - Hypothetical protein YwcB (Protein is coded in complementary strand; from 283307 to 282996)