Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 2010067
End position: 2010093
Length: 27

DNA sequence
>NC_019896, from 2010067 to 2010093 (27 bp); Bacillus subtilis subsp. subtilis str. BSP1 GTTCTTCATATTCTTCATATTCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2009892-2010140	Sequence	A7A1_2757 - Hypothetical protein (Protein is coded in complementary strand; from 2010140 to 2009892)