Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 313452
End position: 313478
Length: 27

DNA sequence
>NC_019896, from 313452 to 313478 (27 bp); Bacillus subtilis subsp. subtilis str. BSP1 TGCTGTCCTTGTTGTCCTTGCTGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 313086-313631	Sequence	A7A1_0211 - Spore coat protein GerQ (Protein is coded in complementary strand; from 313631 to 313086)