Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 1612429
End position: 1612458
Length: 30

DNA sequence
>NC_019896, from 1612429 to 1612458 (30 bp); Bacillus subtilis subsp. subtilis str. BSP1 ATAAAAAAGAATAAAAAAGTATAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1612187-1612468	Sequence	A7A1_3535 - Hypothetical protein YqfZ (Protein is coded in complementary strand; from 1612468 to 1612187)