Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 2652062
End position: 2652091
Length: 30

DNA sequence
>NC_019896, from 2652062 to 2652091 (30 bp); Bacillus subtilis subsp. subtilis str. BSP1 TTTTTTATTTTTGTTTTTTTCTTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2652054-2652236	Sequence	A7A1_1495 - Hypothetical protein YkzE (Protein is coded in complementary strand; from 2652236 to 2652054)