Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 1943165
End position: 1943200
Length: 36

DNA sequence
>NC_019896, from 1943165 to 1943200 (36 bp); Bacillus subtilis subsp. subtilis str. BSP1 ATATCAGGTTTGACATCAGGTTTTGCATCAGGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1942907-1943380	Sequence	A7A1_2821 - Hypothetical protein YozR (Protein is coded in complementary strand; from 1943380 to 1942907)