Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 3845352
End position: 3845387
Length: 36

DNA sequence
>NC_019896, from 3845352 to 3845387 (36 bp); Bacillus subtilis subsp. subtilis str. BSP1 TGATCTTGGTTTTGATCTTTATTTTCGTCTTGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3845307-3846761	Sequence	A7A1_3306 - Hypothetical protein YbbR (Protein is coded in complementary strand; from 3846761 to 3845307)