Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis str. BSP1
Start position: 2335533
End position: 2335595
Length: 63

DNA sequence
>NC_019896, from 2335533 to 2335595 (63 bp); Bacillus subtilis subsp. subtilis str. BSP1 GTTTTTATTATTGTTGTTGTTGCGTTTATTTTTTTTGTTGTTGTTATTCTTCTTGTTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2333743-2335893	Sequence	A7A1_3421 - Translation initiation factor IF-2 (Protein is coded in complementary strand; from 2335893 to 2333743)